Webb19 apr. 2011 · In the present study, we demonstrate that the Escherichia coli–Bacillus megaterium shuttle vector pHIS1522 can be used as a versatile expression vector. … Webb27 feb. 2024 · IPTG act as a molecular mimic of allolactose and initiate transcription of lac operon and trigger expression of the inserted genes under the control of this Lac operon (in this case HriGFP gene). The HriGFP pet28+ construct was directly transformed in E. coli (BL21DE3 cells), however, for transformation in Bacillus megaterium the gene was sub ...
HriGFP Novel Flourescent Protein: Expression and Applications
WebbTaKaRa pni his Pni His, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more Webbtor (pHIS1522, MoBiTec GmbH. Germany) using appropriate restriction endonuclease sites. Fragments of TcdB (TcdB Frags, Table 1) were generated via PCR; catalytic null proteins, TcdB D286A,D288A(TcdB Null) and TcdBD1849–2366 (NT-1848 Null), were created by site-directed mutagenesis (Quikchange II-XL, Agilent Technologies). DNA … hill advisory services
Brevibacillus The Brevibacillus TaKaRa Bioz
Webb11 apr. 2024 · pair 5556, bases 5261556 were AGI-6780 chemical information amplified and ligated into pHis1522-TcdB1-5260 through SpeI and BamHI restriction sites. The resulting construct pHis1522-TcdB1556 encodes the C-terminal truncated TcdB1852. All constructs were sequenced. WebbTable S1. Oligonucleotides used in this study. Related to STAR Methods section. Name Sequence (5'-3') Purpose BoNTA_10R GGCCGGCATGCGGCCGGTACCCTCACTGCAGCGGACGTTCGCC Webb21 mars 2016 · Size-reduced pHIS1522 variant with sequence for C-terminal StrepII-tag fusion (including stop codon directly downstream of the tag). pN-His-TEV1622 Like … smart air company